Paper Title
The Patatin Gene-Specific Oligonucleotide Primers

Abstract
Potatoes are the fourth most important crop in the world after wheat, rice and corn. Potatoes have many benefits such as food, vodka, starch, glue, fuel and dyes etc. When more consumers, it make the market have high demand but the native potato quality is not good. Therefore, there is a study of potatoes to develop new species. Including finding ways to improve the process to make potatoes faster and more productive. The researcher was interested the patatain gene, which is a glycoprotein found in potatoes about 20-40%. The patatin is responsible for protein storage by the researchers studied the molecular level of this gene. I designed the primer of patatin gene, which is 5,313 bp, consisting of 7 exon and 6 intron using the FastPCR v.6 program. All 5 pairs are P1, P2, P3, P4 and P5. The pair of primers are designed as follows: P1 Forward primer 5’gttgtagtcggacccacac3’and Reverse primer 5’tcgagaatggtagccgga3’corresponding to the bases 383 bp. P2 Forward primer 5’tccggctaccattctcgaa3’and Reverse primer 5’ctaaacacgtcccatctc3’ corresponding to the bases 1,261 bp. P3Forward primer 5’gctctcattaggcactggca3’and Reverse primer 5’aactacaacccgagacctt3’corresponding to the bases 2,028 bp. P4 Forward primer 5’acagaagttgccatctcaagc3’and Reverse primer 5’gaacgatccacacaggaaaagc3’corresponding to the bases 2,467 bp. P5 Forward primer 5’gctctcattaggcactggca3 ’and Reverse primer 5’gaacgatccacaggaaagc3’ corresponding to the bases 1,622bp. The PCR during the annaling period of 50-60 °C, it was found that only 4 pairs of primers that could be used to increase the amount of DNA were P1, P3, P4 and P5. Therefore, this research is the basic information on how to apply the suitable primer of the patatin gene to be used for biotechnology benefits. Keywords: Patatin gene, Primer, Oligonucleotide